Translation for "discriminating" to finnish
Translation examples
1997), A?G, was typed by allele-specific PCR using the discriminating primers TGACAATTAGGATTAAGAATATTATA and TGACAATTAGGATTAAGAATATTATG and the common primer AAAATTCCAAGTTTCAGTGTCACATA to generate specific 145-bp products. The set of Y binary marker alleles ca
1997), G, kirjake luona allele- erityinen PCR kohteleva arvostelukykyinen alkeiskirja TGACAATTAGGATTAAGAATATTATA ja TGACAATTAGGATTAAGAATATTATG ja alhainen alkeiskirja AAAATTCCAAGTTTCAGTGTCACATA jotta kehittää erityinen 145-bp hedelmä asento -lta Y-KIRJAIN binääri merkitsijä alleles joutua luona ainoa yksilö jälkisäädös olla alistaa jotta koska “the Y-kirjain haplogroup.” -lta 718 näyte, 717 hirveä ardor haplogroups arvata model after kivijalka -lta tunnettu phylogeny, ainoastaan ainoa Käytävä koettaa (PKH134) epäonnistua jotta kuvailla laveasti aikaa SRY –1532 ja M17 loci.
adjective
So, what are the secrets of discriminating the types glass for window and door?
Joten, mitkä ovat salaisuudet, jotka erottavat ikkunaluukkujen ja ovien tyypin lasin?
Her submission was based on the ‘but for’ test, which states that if a female worker does not receive the same benefits as her male counterpart, all other things being equal, she is the victim of discrimination based on sex.
Hän vetosi ainoaan erottavaan tekijään perustuvaan lähestymistapaan (”but for” -testi), jonka mukaan naispuolista työntekijää, joka kaikkien muiden olosuhteiden ollessa samanlaisia ei saa samoja etuuksia kuin miespuolinen työntekijä, syrjitään sukupuolen perusteella.
In order to refer to the LSD-like psychedelics, scientific authors have used the term "classical hallucinogen" in the sense defined by Glennon (1999): "The classical hallucinogens are agents that meet Hollister's original definition, but are also agents that: (a) bind at 5-HT2 serotonin receptors, and (b) are recognized by animals trained to discriminate 1-(2,5-dimethoxy-4-methylphenyl)-2-aminopropane (DOM) from vehicle.
Viitattaessa LSD:n kaltaisiin psykedeeleihin, tutkijat käyttävät usein ilmaisua "klassiset hallusinogeenit" R. A. Glennonin (1999) määrittämällä tavalla: "Klassiset hallusinogeenit ovat aineita jotka täyttävät Hollisterin määritelmän, sekä (a) sitoutuvat 5-HT2-serotoniinireseptoreihin ja (b) jotka koulutetut koe-eläimet erottavat epäaktiivisista aineista."
adjective
Observing minds and discriminating souls know religion when they find it in the lives of their fellows.
Havainnoivat mielet ja erittelevät sielut tunnistavat kyllä uskonnon, kun he löytävät sen kaltaistensa elämästä.
The universe is not like the laws, mechanisms, and the uniformities which the scientist discovers, and which he comes to regard as science, but rather like the curious, thinking, choosing, creative, combining, and discriminating scientist who thus observes universe phenomena and classifies the mathematical facts inherent in the mechanistic phases of the material side of creation.
Universumi ei ole niiden tiedemiehen löytämien lakien, mekanismien ja yhdenmukaisuuksien kaltainen, joita hän tulee pitäneeksi tieteenä, vaan mieluumminkin se on sen uteliaan, ajattelevan, valintoja tekevän, luovan, yhdistelevän ja erittelevän tiedemiehen kaltainen, joka tällä tavoin tekee huomioita maailmankaikkeuden ilmiöistä ja luokittelee luomistuloksen aineellisen puolen mekanistisiin vaiheisiin luonnostaan sisältyviä matemaattisia tosiasioita.
adjective
Hensel was interested in the exact power of a prime which divides the discriminant of an algebraic number field .
Hensel oli kiinnostunut tarkka voimaa, prime, joka jakaa discriminant on Lukukunta.
And if we can discriminately use our attitude towards ourselves, towards others and towards the society, everything will work out.
Jos käytämme erotuskykyämme ja tarkistamme asennettamme itseämme, toisia ihmisiä ja yhteiskuntaa kohtaan, kaikki tulee toimimaan.
The Commission has found that national regulators' understanding differs as to the exact scope and application of the "non-discrimination obligation" and that their monitoring and enforcement also vary.
Komissio on havainnut, että kansalliset sääntelyviranomaiset ymmärtävät "syrjimättömyysvelvoitteen" tarkan soveltamisalan eri tavoin ja että myös sen seurannassa ja täytäntöönpanon valvonnassa on vaihtelua.
The aid shall be granted without discrimination as to the identity of the carrier or type of service and without limitation as to the precise route to or from the remote region.
Tukea myönnettäessä ei saa harjoittaa syrjintää, joka perustuu liikenteenharjoittajan henkilöllisyyteen tai palvelun tyyppiin, eikä siihen saa liittyä rajoituksia, jotka koskevat tarkkaa reittiä kyseiselle syrjäiselle alueelle tai siltä pois.
Accurate microhotplate temperature measurements are crucial for the discrimination and quantification of gas species, while reliable, long-term operation demands that the microhotplate's temperature sensors be either highly stable or able to sense when they've drifted, a functionality known as a "built-in self test" (BIST).
Tarkka microhotplate lämpötilan mittaukset ovat ratkaisevan tärkeitä syrjinnän määrän ja kaasun laji, mutta luotettava, pitkäaikainen käyttö vaatii microhotplate n lämpötila-anturit ovat joko erittäin vakaita tai pystyvät aistimaan kun he ovat ajautuneet, toiminnallisuutta kutsutaan "sisäänrakennettu itsensä test "(BIST).
Although, the mechanism for self-discrimination in parasites is not yet known.
Tarkkaa hermomyrkyllisyyden mekanismia ei toistaiseksi tunneta.
In some cases, minorities are discriminated against simply because it is inefficient to make a concerted effort at a fair allocation.
Sama rajoitus koskee myös ihmistä, sillä monille yhtälöille ei tosiaankaan ole yksinkertaisesti mahdollista saada tarkkaa ratkaisua.
In 1936, the British-based Jewish newspaper The Jewish Chronicle reported after a visit to Tallinn by one of its journalists: "Estonia is the only country in Eastern Europe where neither the Government nor the people practice any discrimination against Jews and where Jews are left in peace.... the cultural autonomy granted to Estonian Jews ten years ago still holds good, and Jews are allowed to lead a free and unmolested life and fashion it in accord with their national and cultural principles."
Walden ja Serlachius tekivät matkasta raportin, jossa he totesivat seuraavaa Ukrainan silloisesta valtiollisesta tilanteesta: »Maan, jossa 35 milj. asukasta, jolla ei ole ollut itsehallinnon ituakaan, jolta puuttuu sekä poliittiset ja maantieteelliset että tarkat etnografiset rajat, ja jonka kieli vuosisatoja on ollut poljettuna ja jota kieltä ei puhu eikä ymmärrä sivistyneistön enemmistö, ei ole helppoa luoda järjestettyä hallitusta eikä arvovaltaa sille.»
How many English words do you know?
Test your English vocabulary size, and measure how many words you know.
Online Test