Käännösesimerkit
substantiivi
Jos osakkeiden merkitsijälle annetaan yhtiön hallussa olevia omia osakkeita, merkitsijä saa oikeuden osinkoon ja muut osakkeenomistajan oikeudet, kun osakkeet on merkitty ja maksettu.
If existing shares, held by the Company, are given to the subscriber of shares, the subscriber shall be given the right to dividend and other shareholder rights when the shares have been subscribed and paid.
Osakkeiden kirjaus Merkityt ja täysin maksetut osakkeet kirjataan merkitsijän arvo-osuusti-lille.
Shares subscribed for and fully paid shall be registered in the book-entry account of the subscriber.
Merkityt ja täysin maksetut osakkeet kirjataan merkitsijän arvo-osuustilille.
Registration of Shares Shares subscribed for and fully paid shall be registered in the
Merkitsijä on oikeutettu siirtämään Optio-oikeudet vapaasti kolmannelle osapuolelle.
The subscriber is entitled to freely assign and transfer the Warrants to any third party.
Osakkeiden kirjaus Merkityt ja täysin maksetut osakkeet kirjataan merkitsijän arvo-osuustilille.
Registration of Shares Shares subscribed for and fully paid shall be registered in the book-entry
Todistus sisältää sijoittajan merkitsemien yksittäisten osakkeiden numerot, merkintäpäivämäärän, kohdeyrityksen nimen ja merkitsijän nimen.
The certificate contains the numbers of the individual shares that the investor has subscribed for, the date of subscription, the name of the target company, and the name of the subscriber.
Osakkeenomistaja tai muu sijoittaja, joka on merkinnyt Tarjottavia osakkeita Ensisijaisen Merkintäoikeuden nojalla (”Merkitsijä”), on oikeutettu merkitsemään Tarjottavia osakkeita Toissijaisessa Merkinnässä.
A shareholder or other investor who has subscribed for Offer Shares based on the Primary Subscription Right ("Subscriber"), is entitled to subscribe for Offer Shares in the Secondary Subscription.
Optio-oikeudet annettiin vastikkeetta siten, että kutakin kolmea merkittyä ja maksettua osaketta kohden merkitsijä sai yhden optio-oikeuden.
The warrants were given free of charge in the way that the subscribers received one warrant per each three subscribed and paid shares.
Rahavastiketta vastaan merkittiin yhteensä 45.212.000 osaketta, joiden suurimmat merkitsijät olivat Inission AB (28.500.000 osaketta), Etra Invest (7.000.000 osaketta) ja Onvest (3.500.000 osaketta).
Against cash payment, a total of 45,212,000 shares were subscribed, and thereby the largest subscribers were Inission AB (28,500,000 shares), Etra Invest (7,000,000 shares) and Onvest (3,500,000 shares).
substantiivi
Kun olet luonut täsmähakukoneen, voit sisällyttää sivustoja Google-merkitsijällä.
Once you've created a Custom Search Engine, you can include sites using the Google Marker.
Nämä tunniste 11 kilpa-ajohevoset haplogroups ja 503 konserni binääri merkitsijä/STR haplotypes.
These identified 11 stable haplogroups and 503 combination binary marker/STR haplotypes.
2001) ja kanisteri niin olla katsella koska merkitsijä -lta Afrikkalainen Y-KIRJAIN kromosomi.
2001) and can thus be regarded as a marker of African Y chromosomes.
Voit tehdä tämän yksinkertaisesti taas sävy control mukautetaan aiemmin aloittaa alentava resistenssi 5 merkitsijä ja parantaa sävy.
To do this you simply turn the tone control past the 5 marker to start reducing resistance, thus adjusting and enhancing the tone.
Yksinkertainen ali- tai ylivalottumisen tarkistus Videotason merkitsijän värit ja kuvien erityiset videon kirkkaustasot auttavat saavuttamaan optimaalisen valotuksen ja ihon sävyn käyttäjän valitseman videosignaalin tason mukaan.
Video Level Marker colors specific video brightness levels in images to help achieve optimum exposure and skin tone according to a user-selected target video signal level.
Bianchi Ei, Bailliet G, Uhittelu CM, Verilöyly RF, Rothhammer F-kirjain, Räystäspääsky-Marignac VL, Rangaistava SD (1997) Juontaa -lta Amerindian Y-KIRJAIN- kromosomi koska johtaa luona analyysi -lta kuusi monimuotoisuus merkitsijä.
Bianchi NO, Bailliet G, Bravi CM, Carnese RF, Rothhammer F, Martinez-Marignac VL, Pena SD (1997) Origin of Amerindian Y-chromosomes as inferred by the analysis of six polymorphic markers.
1997), G, kirjake luona allele- erityinen PCR kohteleva arvostelukykyinen alkeiskirja TGACAATTAGGATTAAGAATATTATA ja TGACAATTAGGATTAAGAATATTATG ja alhainen alkeiskirja AAAATTCCAAGTTTCAGTGTCACATA jotta kehittää erityinen 145-bp hedelmä asento -lta Y-KIRJAIN binääri merkitsijä alleles joutua luona ainoa yksilö jälkisäädös olla alistaa jotta koska “the Y-kirjain haplogroup.” -lta 718 näyte, 717 hirveä ardor haplogroups arvata model after kivijalka -lta tunnettu phylogeny, ainoastaan ainoa Käytävä koettaa (PKH134) epäonnistua jotta kuvailla laveasti aikaa SRY –1532 ja M17 loci.
1997), A?G, was typed by allele-specific PCR using the discriminating primers TGACAATTAGGATTAAGAATATTATA and TGACAATTAGGATTAAGAATATTATG and the common primer AAAATTCCAAGTTTCAGTGTCACATA to generate specific 145-bp products. The set of Y binary marker alleles ca
How many English words do you know?
Test your English vocabulary size, and measure how many words you know.
Online Test