Перевод для "primers" на финский
Фразы в похожем контексте
Примеры перевода
сущ.
Called primer in building one of the primer species.
Called pohjamaali rakentamisessa yksi pohjamaali lajeja.
When choosing a primer should pay attention to the type of surface on which the primer is applied.
Valittaessa pohjamaali tulisi kiinnittää huomiota pinnan tyyppi, jolle pohjamaali levitetään.
Products Akvi Primer - Universal all-round primer for inner surfaces
Tuotteet Akvi Primer - Joka paikan pohjamaali sisäpinnoille
surface primer for better adhesion.Moreover, the primer is selected under the base (concrete, brick, drywall).Then spend a vapor barrier.On the foam side (inside wall) is applied silicone sealant or sealed with its special insulation film.
pinta pohjamaali paremman tarttuvuuden.Lisäksi pohjamaal
Products Diccoplast Elastic Primer - Elastic primer for interior and exterior use
Tuotteet Diccoplast Elastic Primer - Elastinen pohjamaali myös ulkokäyttöön
сущ.
The primer can be applicated with felt pads (non flammable primer!) or by using the new primer application system (aqueous primer).
Pohjustusainetta voidaan levittää sienellä (ei syttyvä pohjustusaine!) tai käyttäen uutta pohjustusaineen levitystekniikkaa (vetinen pohjustusaine!).
A primer to the blockchain, distributed ledgers, and Hyperledger technologies.... [+
edX Pohjustus lohkoketjuun, hajautetut pääkirjat ja Hyperledger-tekniikat.... [+
A super important product to remember, is an eyeshadow primer.
Silmämeikin pohjustusaine Erittäin tärkeä tuote muistaa on luomivärinpohjustaja.
1 Apply Smooth Affair Facial Primer
Posket Huulet 1 Levitä sormenpäilläsi ohut kerros Smooth Affair meikin pohjustus- ja kirkastusvoidetta koko kasvoille.
Prime your lids and set the primer, so that it’s not sticky.
Pohjusta luomet ja kiinnitä pohjustus, jotta luomi ei ole tahmea.
Alternatively, you can take a primer for plastic or priming enamel in the form of a spray.
Vaihtoehtoisesti voit ottaa pohjamaali muovi tai pohjustus emali muodossa spray.
Delineation to those areas that may not come into contact with the primer is in the range of tenths of a millimetre.
Raja alueille, jotka eivät saa joutua kosketuksiin pohjustusaineen kanssa, voidaan laskea millimetrien kymmenesosina.
A dark primer (which would actually be a natural choice for a dark topcoat) impairs the reflection behavior of the cold pigments.
Tumma pohjustusaine (joka olisi luonnollinen valinta tummalle pintamaalille) heikentää kylmien pigmenttien heijastavaa vaikutusta.
Among the other books were a primer, some child's readers, numerous picture books, and a great dictionary.
Muiden kirjain joukossa oli aapinen, eräitä lasten lukukirjoja, lukuisia kuvakirjoja ja iso sanakirja.
сущ.
Ammunition components, such as blanks, bullets, bullet tips, casings, gun powder, primers, and shotgun shells
ampumatarvikeosat, kuten paukkupatruunat, luodit, luotien kärjet, hylsyt, ruuti, nallit ja haulikoiden patruunat.
Metal or plastic fabrications such as primer anvils, bullet cups, cartridge links, rotating bands and munitions metal parts;
Metalliset tai muoviset komponentit kuten esimerkiksi nallin alasimet, hylsykupit, vyönivelet, johtorenkaat ja ampumatarvikkeiden metalliosat;
‘ammunition’ means the complete round or the components thereof, including cartridge cases, primers, propellant p
’ampumatarvikkeilla’ kokonaisia patruunoita tai niiden komponentteja, mukaan luettuina hylsyt, nallit, ruuti, luodit ja ammukset, joita käytetään liitteessä I tarkoitetussa ampuma-aseessa, edellyttäen, että nämä komponentit ovat luvanvaraisia kyseisessä jäsenvaltiossa;
“ammunition” means the complete round or the components thereof, including cartridge cases, primers, propellant powder, bullets or projectiles, that ar
’ampumatarvikkeilla’ kokonaisia patruunoita tai niiden komponentteja, mukaan luettuina hylsyt, nallit, ruuti, luodit ja ammukset, joita käytetään ampuma-aseessa, edellyttäen, että nämä komponentit ovat luvanvaraisia asianomaisessa jäsenvaltiossa;
Dealers and brokers should be able to refuse to complete any suspicious transaction for the acquisition of complete rounds of ammunition or live primer components of ammunition.
Asekauppiaiden ja -välittäjien olisi voitava kieltäytyä saattamasta päätökseen epäilyttäviä liiketoimia, joiden tarkoituksena on kokonaisten patruunoiden tai patruunoiden käyttämättömien nallien hankkiminen.
For the purposes of this Directive, “ammunition” shall mean the complete round or the components thereof, including cartridge cases, primers, propellant powder, bullets or projectiles, that are used in a firearm, provided that those components are themselves subject to authorisation in the relevant Member State.
Tässä direktiivissä ’ampumatarvikkeilla’ tarkoitetaan kokonaisia patruunoita tai niiden komponentteja, mukaan luettuina hylsyt, nallit, ruuti, luodit ja ammukset, joita käytetään ampuma-aseessa, edellyttäen kuitenkin, että nämä kom
сущ.
1997), A?G, was typed by allele-specific PCR using the discriminating primers TGACAATTAGGATTAAGAATATTATA and TGACAATTAGGATTAAGAATATTATG and the common primer AAAATTCCAAGTTTCAGTGTCACATA to generate specific 145-bp products. The set of Y binary marker alleles ca
1997), G, kirjake luona allele- erityinen PCR kohteleva arvostelukykyinen alkeiskirja TGACAATTAGGATTAAGAATATTATA ja TGACAATTAGGATTAAGAATATTATG ja alhainen alkeiskirja AAAATTCCAAGTTTCAGTGTCACATA jotta kehittää erityinen 145-bp hedelmä asento -lta Y-KIRJAIN binääri merkitsijä alleles joutua luona ainoa yksilö jälkisäädös olla alistaa jotta koska “the Y-kirjain haplogroup.” -lta 718 näyte, 717 hirveä ardor haplogroups arvata model after kivijalka -lta tunnettu phylogeny, ainoastaan ainoa Käytävä koettaa (PKH134) epäonnistua jotta kuvailla laveasti aikaa SRY –1532 ja M17 loci.
How many English words do you know?
Test your English vocabulary size, and measure how many words you know.
Online Test